PENYA BOGARDE. LA PENYA DEL BARCELONISME PROLETARI

Tribuna Winston
Bogarde. L'organ oficial de la Penya Bogarde de Premià de Mar. LA PENYA QUE MAI FALLA.
Òrgan d'expressió oficial de la Penya Bogarde, fundat l'any 2007 del segle XXI a la vila de Premià de Mar / El Maresme / Països Catalans / Univers / Tot.


dissabte, 23 de juliol de 2011

LA LLARGA DURADA (L.P.) D'UN JULIOL DE BOJOS I LES PRIMERES PASSES DEL SUPERBARÇA 2011-2012


DARRERÍSSIMA HORA

El soci Joan "Karloff" Estruch i la seva companya Laura-Elena Harring s'han casat a LAS VEGAS. L'enllaç s'ha materialitzat a les 12.00 del migdia (hora catalana). La parella ha decidit no dedicar massa temps a la lluna de mel i tornar tot seguit a Barcelona per incorporar-se a les tasques revolucionàries. Admirable decisió!
Informem de que el soci Joan Estruch ha estat nomenat SINDIC DE LA MASSA SOCIAL i haurà d'intercedir davant les directives de torn. Visca el Barça!




DARRERA HORA

EL MISSATGER VISITA LA CAMBRA D'UN HOTEL DE LONDRES. "FRANCISQUITO" DORM PROFUNDAMENT (O PITJOR...).
ESTARÀ SOTA ELS EFECTES D'UN "ARSÈNIC" WENGER?
ELS SIMPTOMES DEL POST-BADAL COMENCEN A SER INQUIETANTS.
EL MISSATGER PASSA REVISTA... AL PEU DEL CANÓ.



EL GRANDIÓS BARÇA
DEL GRAN THIAGO

FA CREIXER LA
VITRINA DEL MUSEU.
JA TENIM LA COPA AUDI

I ENS ENTRENEM A FONS
PER FER UN GAMPER HISTÒRIC



BAYERN MÜNCHEN 0, BARÇA 2. La millor novetat del Barça 2011-2012 es diu THIAGO. Dos raons aconsellen destacar el gran THIAGO. La primera és que el nano és bo. La segona -la més important- és que quan més THIAGO menys FRANCISQUITO. Aquesta és la gran lliçó de la COPA AUDI: Thiago barra el pas a Francisquito. Entretant ERIC CANTONA segueix escalfant la banqueta i d'adapta meteòricament a l'equip. L'aposta per Cantona és molt segura. Eric s'aixecarà un dia de la banqueta, tocarà la bimba, fara sonar la trompeta i cohesionarà l'esperit revolucionari del nostre equip.

"Tito Vilanova, i no Guardiola, sap molt bé el significat de l'aposta Cantona"

(Núria Feliu, cantant i activista)


SOM CAMPIONS
DE LA COPA AUDI!







Tot es complica i tot és part de la més gran de les històries. Endreçar i organitzar informacions és una tasca complexa. Anem per parts.




PART 1.
Futbol internacional a Alemanya. El Barça arrassa l'Internacional de Porto Alegre amb una tanda de penals d'antologia. Anem bé. Tito Vilanova porta Cantona entre cotó fluix i Nenuco.


Mica en mica, Eric Cantona s'adapta al club
i la banqueta li serveix per entrar en calor.
Seguirem amatents al retorn del missil francobritànic.





PART 2.
La revolució no fa vacances. Passades les sessions d'esbarjo, camping i gatzara, torna amb tota la força la revolta bogardiana. Els fets del Clot tenen un element important. Els membres històrics de la Penya es van fer forts al balcó d'un habitatge i els mossos rosellians van atonyinar-los de valent.


Més tard, gràcies a la xarxa social blaugrana, els neo-bogardians Missatger, Òscar, Watts, Laura-Elena i Estruch van fer acte de presència per oferir llur resistència al desnonament del soviet del Clot.


La Srta. Watts i el nostre soci O.R.C.
escridassant als mossos rosellians



La Sra. Laura Elena d'Estruch
organitza la sentada davant
les forces oficialistes ...



El soci Missatger encapçala
la manifestació de protesta al Clot


El Clot pren el relleu a la comuna Sants-Hostafrancs i esdevé el punt neuràlgic de la resistència. Dyango canta i dirigeix amb energia tots els estrats combatents.


El rosellisme opta per un pacte antinatura amb l'agent madridista Cristobalito Gazmoño. Foc, arreu foc!






Part 3. Primers senyals d'internacionalització de les lluites. Indibogardians es concentren a Piccadilly Circus (Londres), Times Square (Nova York), Colisseu (Roma), Plaza del Zócalo (Mèxic DF), Ponte Vecchio (Florència) i Trenchtown (Kingston, Jamaica). S'anuncia un agost bogardinternacionalista.

Nota: Tenim les proves. Cristobalito Gazmoño esmenta i insulta el soci Òscar. Escolteu pacienment el video adjunt...

YouTube - Tony Leblanc - Cristobalito Gazmoño

www.youtube.com/watch?v=_kgFrI3lNhA3 min - 26 May 2009 - Subido por JaimelareHumor
Tony Leblanc interpreta aun niño en este sketch de los años 60.



Cap de setmana estival
carregant les bateries revolucionàries
i la temporada triomfal


Naomi i Laura-Elena no en tenen prou amb L'Òscar i l'Estruch i ho deixen clar en aquest memorable video. Després que els dos socis es reincorporessin a les barricades, les dues dames van continuar amb les seves línies d'atenció. Mireu el video clicant damunt la pantalleta.

Dailymotion - Mulholland Drive Laura Harring Naomi Watts kiss - a ...

www.dailymotion.com/.../xdw9ob_mulholland-drive-laura-harring-nao...1 min - 2 Jul 2010
Mulholland Drive Laura Harring Naomi Watts kiss. men24 By men24. Subscribe. 18822 views | 0 com. | 17 fav. ...

PROBLEMES PEL SR. ESTRUCH

Després de visionar l'espectacular video de les Sres. Laura Elena Harring d'Estruch i Naomi Watts "parlant" de les seves coses, una nova exclusiva "bomba"del nostre agent Smart 86 pot complicar i molt les relacions entre alguns socis de la Penya, ja que després del casament del Sr.Estruch amb la Srta. Maria Elena, ara apareix el soci Sr.Missatger molt ben acompanyat per la Sra. d'Estruch.
Mentrestant al soci O.R.C. s'el veu fent fotos no sabem ben bé a qui , al costat de la seva companya de roulotte, la Srta. Watts ...


Naomi Watts al camping La Ballena Alegre

Heus aquí el descans dels guerrers. L'aixecament popular mereix petits i intensos parèntesis. La fotografia de dalt ens presenta l'habitacle on reposa (agitadament) un dels nostres socis (O.R.C.) en companyia de l'actriu Naomi Watts.


Més avall podreu comprobar com el soci X.P.K. opta per la cultura elitista anant al teatre per presenciar tot un Jordi LP.

EL BARÇA JA PARLA EN EL CAMP
(I CANTONA S'ESTRENA A LA BANQUETA)

Crònica de Joan Trencapins. TV3. Split.

Un Barça estratosfèric inicia la temporada jugant com un cor d'àngels celestials i provoca l'admiració de tota l'Europa Oriental. Malgrat la deplorable samarreta i amb Cantona a la banqueta sense minuts per escalfar, els blaugranes s'exhibeixen a cor obert. Crònica sintètica de la jornada.





Foto: Miguel Ruiz - FCB

Debut amb empat a Split (0-0)

El Barça ha empatat contra el Hajduk Split en el primer partit de la pretemporada. Tot i la superioritat pel que fa a joc, els de Guardiola no han pogut superar la porteria croata. Villa, Soriano i Jeffren han tingut les millors ocasions.


EL RETORN DEL FACTOR XPK
(Xavier Puro Kalikenyo).

JORDI LP (Long Play, llarga durada)
s'apunta a la revolta
i aporta la teoria de
"La llarga durada revolucionària"
(Long Play Revolution)
.



Ens arriben notícies des de la ciutat Comtal. El president d'honor de la Penya Barcelonista Winston Bogarde, soci Xavier Puro Kalikenyo, s'incorpora a les garrotades insurgents i suma un nou personatge a l'orla triomfal de la revolta bogardiana. Jordi LP, mite lletgista, personatge extraterrestre, esser iconoclasta, referent intercontinental de l'humor incontinent i demiurg solvent, entra a tota vela en el dispositiu revolucionari bogardià.


Xavi Puro Kalikenyo ha establert una aliança amb el mite de la llarga durada (L.P.) i, justament en el punt exacte, rubrica una adhesió invencible. XPKalikenyo va assistir (junt amb la seva muller E.S.) al zènit del teatre tragicòmic català. Un punt de descans per carregar bateries i afrontar l'agost de foc, el Gamper anarcoesportiu i la supercopa soviètica. Heus aquí la crònica que XPK ens ha enviat des de l'escenari del crim teatral.



CARTA AL POBLE BOGARDENC.

No sense sacrifici, he anat a la recerca de noves aliances per fer de la revolta un camí exitós. El meu llarg silenci respon a una imperiosa necessitat de camuflatge. La revolta ens obliga a sacrificis mai ben pagats.

He acompanyat en Jordi LP, transvestit d’andalús perdut pel nord, en un llarg viatge. I juro que no he entès res. M’he esforçat, però encara no se si el que he vist és real o imaginari.

Això sí, hem aconseguit treure’n bon us de l’herba seca del Camp Nou cremant-la al botafumeiro de la catedral de Santiagu amb un "colocón" final estrafolari i anticlerical, antifeixista, lleugerament antimonàrquic i pro-nosequéexactament.

Almenys, el globus sublim que hem agafat tos plegats ha servit per posar cadascú al seu lloc.

Pel camí ens hem trobat amb un vellet, simpàtic i combatent anarquista que de l’herba n’ha tret negoci. Més d’un KaliKenyo ens ha unit en vetllades plenes de metafísica incorpòria. Gràcies a ell, inspirador de la “incineració”, hem pogut, finalment mostrar al món, tal com son: els clergues, monarques monàrquics pro-Joanca, aristòcrates i algun fatxenda que passava per allí.

I aquí em trobeu, porto aquesta nova aliança per a la nostra causa: Jordi LP, esforçat treballador i aliança suggerida fa poc per un anònim col·laborador del blog. I a més de la mà d’un vell anarquista lluitador.

Convençut com estic de la victòria final he volgut sumar i no restar, cosa que ens cal ara més que mai.

Puro Kalikenyo, 22 i 23 de juliol de 2011


DARRERA HORA

El nostre agent Maxwell Smart 86 no fà vacances i, desplaçat al camping La Ballena Alegre, ens envia en exclusiva la imatge del nostre soci O.R.C. amb la Srta. Naomi Watts dins la moderna roulotte, fent ús del regal que se li va concedir recenment...


Mentrestant, el gat Zelig no perd el temps ...


ESTRUCH TIRA PEL DRET I ENS PRESENTA
LA SEVA SENYORA MEXICANA.
HEUS AQUÍ LA
LAURA ELENA HARRING D'ESTRUCH,
LA PERLA DEL CARIB, MISS MULHOLAND DRIVE,
LA DEESA DEL BOGARDISME MARIACHI.
BENVINGUDA A LA PENYA.
FELICITATS SOCI ESTRUCH.




63 comentaris:

Òscar Roig i Carrera ha dit...

Avui, dia del meu aniversari, el Barça ha celebrat el seu primer partit amistós de la temporada. Serà un senyal? Més blaugrana que mai aquest any gràcies al meu gat, al Jordi LP i al bogardisme? Bé, en tot cas, què em regalareu?

La Junta Directiva de la Penya Bogarde ha dit...

Amic Roig,

som conscients que la teva vida ha experimentat un gir copernicà i que res serà com abans. El teu barcelonisme ha assolit un tombant que el situarà al bellmig de la dimensió desconeguda. Ara, privilegiat com ets, ja gaudeixes de les vitamines A-B-C-D necessàries per repuntar la metafísica quotidiana que desferma la teva existència. Ara, bogardenc de primera línia com ets, vius sota l'influx d'Alfa i Beta, de les canyeries Biosca, dels helicopters Vilanova, dels gendarmes francesos, del cos (intocable) de les dones més atractives del cosmos (Watts, Bellucci, Feliu, Shakira...) i ja ets part de l'imperi itinerant del Bogardisme transplanetari.

Ets part d'un món que tot just comença la seva escomesa.

Benvingut a la TEMPORADA 2011-2012

MADRIDISTA TINTO DE VERANO ha dit...

BOBALICONES JAJAJAJAJAJA

EL REAL MADRID ARRASA EN LOS ESTADOS UNIDOS UNTÁNDOLE CUATRO GOLES A UN CLUB SUPERMILLONARIO COMO LOS ANGELES GALAXY Y EL PAUPÉRRIMO BARCELONI-TA NO LE METE NI UN SAPO A LOS BALCÁNICOS DE TERCERA FILA.


QUE SIGA VUESTRA FIESTA DE BARRICADAS Y GAZPACHO PELEÓN QUE LO NUESTRO SON GOLES Y MONUMENTOS DE BUEN JUEGO.

¿¿¿¿¿ Y QUIEN C.O.Ñ.O ES ESTE CHORDI L.P ?????

VEO QUE EL PALANGANERO CALIMOCHO DE LA FOTO TIENE LOS OJOS COMO CHAK NICHOLSON.

TOBÍAS: LIMITÁTE A MOVER LA COLA.

JAJAJAJAJAJAJA

EL PERRO TOBÍAS ha dit...

a mandar mi amo, muevo la cola como un ventilador, ahí va:

zzzzzzzzggggguuuuuuu
zzzzzzzzggggguuuuuuu
zzzzzzzzggggguuuuuuu

pero mi amo, quiero moder un poquitín.

MADRIDISTA A TOBÍAS ha dit...

MUERDE CON MODERACIÓN, FIEL TOBÍAS

EL PERRO TOBÍAS ha dit...

gracias mi dueño y señor.

kaf kof kaf kof.

me zampo dos dedos del calimocho y le pongo algodón y agua oxigenada para que no se infecte.

gracias mi dueño y señor.

guauuuuuuuu!!!!!!!!!!!!

El missatger ha dit...

Jordi L.P? Lucki Guri? Fúria Feliu? El bogardisme té el bo i millor de l’avantguarda artística catalana. Solament manca la Regina Dos Santos i l’Empar Moliner i tenim el programa prototípic d’en Cuní. Com a talls publicitaris del “pugrama”, un xampú que no és anticaspa sinó que la crea. Supercaspa: perfecte per a fans d’en Rubalcaba i en Julito Iglesias.

Àngel 'Soulbizarre-Tati' ha dit...
L'autor ha eliminat aquest comentari.
Àngel 'Soulbizarre-Tati' ha dit...

Amics i amigues,

vist des de la grada, jo diria que els punts de referència cuturals del bogardisme capten a la perfecció aquella voraginosa cultura catalana més universal i de la qual JORDI LP és un estendart i pilar fonamental.

Anem per molt bon camí.

LA JUNTA DIRECTIVA ha dit...

La Junta s'ha reunit per procedir a escollir el regal que lliurem al soci ÒSCAR ROIG I CARRERA.

Una nit de ROULOTTE al campung La Ballena Alegre amb Naomi Watts.

li hem deixat al bar Marina de Prmeià de Mar (pregunti per Toni) el sobre amb el ticket i les dades mínimes i instruccions.

Enhorabona.

Alan Smithee ha dit...

una meravellosa galeria de personatges fora de joc.

ho celebrem!

Òscar Roig i Carrera ha dit...

Accepto el regal! Espero golejar aquella nit. Gràcies!

El missatger ha dit...

Protesto!
Això no és un regal, això és la loteria.
Segur que aquella nit l'Òscar no diu la cèlebre frase d'en Bartleby.
Salut i a golejar!

Àngel 'Soulbizarre-Tati' ha dit...

ja m'imagino la roulotte perdent la falca i desplaçant-se sense control per l'esplanada del camping. Pot ser un terratremol. La Watts i l'Òscar de festa i "houses in motion".

Arnau ha dit...

com diria Lluís Llach, això és com el jorn dels miserables...cuanta ràbia que tinc, voldria ser gos des d'ara (gos blaugrana, no Tobias).
Ràbia per l'enveja del que està passant a la Roulotte de la Ballena Alegre.

Molta ràbia!

Òscar Roig i Carrera ha dit...

Podrieu haver-nos agenciat una roulotte del segle XXI, aquesta s'està quedant feta miques (encara més). Naomi, saluda a la concurrència bogardiana!

Naomi Watts ha dit...

Oh, yeah! Oh, yeaaah! Ohhhh, yeaaaahhhhh!

MADRIDISTA ASOMA Y OJEA ha dit...

SUPONGO QUE EL ACOJONE POR LA QUE OS ESPERA PARA CUANDO EL REAL MADRID OS ENMIENDE LA PLANA EN LA SUPERCOPA OS PONE DE TEMBLEQUE CHUNGO.

PARECE UNA WEB DEL SALÓN DEL TURISMO Y DEL SEXO CATAPLÍN.

MIRA QUE SOIS REQUETECHUNGOS Y POCO FUTBOLEROS QUE USAIS EL DEPORTE COMO PRETEXTO PARA SOÑAR COSAS HÚMEDAS Y CHORIPANES DE ESTIERCOL AL POR MAYOR.

TOBÍAS, DESPIERTA A TODO EL CAMPING Y MUERDE SIN PIEDAD A TODO BICHO QUE SE PRESTE.

EL PERRO TOBÍAS ha dit...

pues ya voy mi amo

ggggg uuuuu aaaaa uuuuu
alarido puf pud puf puh boukkkkk


muerdo hombres y mujeres muerdo coches muerdo rulotes muerdo pajaritos

bacanal en La Ballena Alegre


gggggggg kokokokokoko
krkrkrkrkr
ooo lllll chunnnn agg agg agg

placer sanguineo

Dyango ha dit...

ELS COMUNARDS DE BADAL

La comuna de Badal
tornarà a ser gran i plena
endarrera en Rosell
molt ufà i ben superb

bon cop Feliu
bon cop Feliu
defensora del soci
bon cop Feliu

Que tremoli en francisquito
en veient la nostra lluita
quan tirem pedres al cel
quan convé seguem filferros


bon cop...
(bis)

Dyango ha dit...

Hola gent, soc en DYANGO i em sumo a la lluita, oferexio els meus cants i la meva dolçor

penyabogarde ha dit...

seguidors del WEST HAM, aneu a l'enllaç

penyabogarde-goldencorner.blogspot.com

hammers contra "maños"

David Lara ha dit...

dyanguito,
me recuerdas a Cristobalito Gazmoño.
El balance de la gira americana del real madrid es para asustarse, vamos que nos vamos.

David Lara ha dit...

se me olvidaba el detalle:

http://www.youtube.com/watch?v=_kgFrI3lNhA

Àngel 'Soulbizarre-Tati' ha dit...

la figura de Cristobalito Gazmoño podria ser decisiva per escalfar el Gamper.

penyabogarde ha dit...

Dyango de la banda blaugrana i Cristobalito Gazmoño de la banda blanca. Ho estudiarem i procedirem quan la revolució recuperi els batecs després del cap de setmana de campings, aplecs, focs artificials, anades al teatre i xiringuitos. Ara ens arriben notícies de que el gruix de la milicia bogardenca recupera posicions al districte de Sants-Hostafrancs.

Joan Estruch ha dit...

Alto! Alto! Alto!
Estic enfadadíssim amb el Waits Roig!!!!
hauries de renunciar IPSO-FACTO a aquesta escena.

La Naomi em pertany des que anavem junts al parc i menjavem gelats.

M'ha afectat profundament.

Joan Estruch ha dit...

Arnau, procura estalviar la ràbia que la meva encara és més gran. I a veure si la junta posa ordre abans del Gamper per evitar divisions entre tots els bogardistes.

penyabogarde ha dit...

no us dividiu per un tema menor, s'acosta el Gamper, tenim una revolució al carrer, mourinho ha estat ascendit per fer més mal al gènere humà. Molts arguments per estar units fent força.

Òscar Roig i Carrera ha dit...

Que bonic càmeres ocultes, eh? Si hi ha vídeo a veure si me'l passeu! Al meu gat li van els trios. Li he propossat un a la Naomi amb el secretari Estruch, que va molt necessitat pel que es veu, però m'ha dit que s'estimava més amb la Laura Elena Harring, o sigui que se'm gira feina, però espero estar a punt pel Gamper. Tots units fem força!

Anònim ha dit...

la cosa es complica amb les cameres ocultes i si un dia surt a la llum el show del vestidor quan Cantona es tira a la piscina i mostra el seu poder?

Joan Estruch ha dit...

sincerament, una vegada he conegut la Laura-Elena ja li podeu dir a l'Òscar que es confiti la Watts. La Laura-Elena i un servidor ens casem el primer d'agost a Las Vegas.

Com podeu comprobar a la foto és insuperable a tots els efectes.

Joan

LA JUNTA ha dit...

ESTRUCH!!!!!!!

Felicitats, has superat el llistó Bellucci i vas directe a les estrelles.

Quan hagis arribat a Saturn ens envies un e.mail i venim tota la colla des de Sants.

Joan Estruch ha dit...

Qui riu el darrer, riu molt millor.

Amb la Laura-Elena m'he topat
i tot d'una m'he casat!

Des d'avui ja no m'interessa ni el futbol ni anar a missa.

El missatger ha dit...

A tots els que esteu fent al trapella amb dones de l’univers Lynch. Heu de saber que totes elles em prefereixen a mi per raons evidents. Amb tot, a l’univers Lynch tot pot ser doble, i a la missatgeria no tenim problemes d’egoisme ni sentit de la propietat. Ens estimem en aquest nou estiu de l’amor –i de la pluja. Patricia Arquette, les noies d’Inland Empire, les belleses de Twin Peaks... ens estimem.

D’altra banda, la lluita continua. Ahir vam anar amb totes les dones de la missatgeria Lynch al Clot a que uns senyors amb casc i porra s’unissin a nosaltres en aquest compartir l'amor, però no va poder ser. Així que amb la Laura Elena hem decidit passar la nit a les noves barricades del Clot. Per animar al personal Dyango està cantant versions de Public Enemy. Inenarrable. Fight the power en versió bolero! Us ho perdreu? Aquesta nit barricada al Clot!

penyabogarde ha dit...

La redacció del blog ha procedit a una sistematització de totes les informacions. Masses fronts oberts. Sentimentalisme, amor, sexe, futbol, fitxatges, revoltes, madridisme lleig, camping...

Hem decidit anar a fons i organitzar millor el dispositiu informatiu i ajudar al soci.

També hem activat el servei de socors i ajut al soci (el video de Cristobalito Gazmoño és un escarni per la figura del soci Òscar).

MADRIDISTA SIN PALABRAS ha dit...

¿ SI YA NO ME DAIS NI PENA ?

ME PREGUNTO ¿ QUE SENTIMIENTO SE PUEDE EXPERIMENTAR ANTE SEMEJANTE TONTORRONERÍA ?

ESPEREMOS QUE PRONTO EL BALÓN PONGA ORDEN EN LA SALA Y QUE EL REAL MADRID OS DEVUELVA A LA PURA REALIDAD.

TOBÍAS, NO TE REPITAS, SALUDA Y A DORMIR.

EL PERRO TOBÍAS ha dit...

duermo mi amo, guau zzzzzzzzz

pero en sueños me imagino una réplica canina de la señora Laura Elena.

guau pero que muy guau zzzzzzz

Joan Estruch ha dit...

Escric molt de nit, molt de nit i molt de nit i no accepto que un gos tonto faci gracietes sobre Laura Elena.

Jo també em sento part del que el Missatger en diu els Lynchians i beso lynchianes si cal i com cal que no ha estat res.

El meu barcelonisme és de pedra sobre pedra i el meu bogardisme és de ja fa un any, ara tinc moltes ganes d'explicar com em vaig topar amb aquesta Penya.

Farà més d'un any em topo a la web de la RAC1 un recomanament de que el blog del dia era aquest i aixi l'enfilo, crec que tot anava de partits de lliga tractats amb gracia i de gent sorpresa que sortia com en Torrebruno i els germans Calatrava, em vaig enganxar com el pegamento i setmana va setmana vé que estic aquí.

He estat ficat en els exits i no us conec directament però com si fos aixi, les fotos de les celebracions al vostre bar, les fotos del pas zebra del abey road brincant festa, i ara l'amor pels descosits i els bromistes que em prenen les pubilles.

m'ho passo molt bé, ja veieu que és molt de nit i no es facil però m'ho paso pistonudament i conec gent i no sé si vareu fer finalment el finar de casa leopoldo que ben bé m'hauria agradat de fer també.

heu de citar la gent a algun lloc i fer una trobada oi?

jo baixo de La Garriga en poc menys d'uns tres quarts si no hi ha cua. una altra possibilitat seria que quan torneu a fer les trobades de lliga per la tele a la vostra seu ens poseu l'adreça i puc venir si m'ho combino amb la familia.

Podrieu avisar de les cites davant la tele i fer festeig gran ja ja ja que encara portaré el que quedi de la Laura Elena que caram caram l'he coneguda i no la deixo ni un pam.

Gràcies per tot que ho feu pistonut.

Joan / La Garriga / Vallès Oriental

Anònim ha dit...

Laura Goliat és Laura Elena?

El missatger ha dit...

Aquesta nit, a cau d’orella, la Laura Elena G. m’ha reconegut que està tant enamorada d’en Joan Estruch que fins i tot li fa por la intensitat dels seus sentiments.
Els homes amb casc i porres atacaven la barricada, en Dyango cantava versions de Public Enemy en versió bolero, com per exemple Lucharé contra el poder por tu amorsito, mulata de mi locura, els companys i companyes ens conjuràvem per a que els de les porres no passessin i el Clot caigués, i just en aquell moment Laura Elena G. m’ha dit allò: Joan Estruch? Oui, je l’aime.
No sé què té el bogardisme que fa tant sexys als homes i a les dones que el professen.

Òscar Roig i Carrera ha dit...

En Cristobalito no m'insulta fa una descripció acurada del meu físic. Val a dir que com que ell no em va fer una cara nova, a diferència de la resta de companys d'escola, vam acabar fent-nos bons amics. El petó Naomi-Laura Elena sí que és un petó de veritat, no com el de la Pene i la Scarlett! I després encara ve un fragment més interessant! De res per haver-li presentat a la simpàtica mexicana, eh senyor Estruch?

Monica Bellucci ha dit...

Io sono indignata!

Mi fa paura di vedere che io sono partita per vacanze in Australia et io sono ritornata in casa espaventata di vedere che il mio Oscar, il mio Struccio, il mio Tati, il mio segretario, il mio calichegno pureta, tutti i bogardiani hanno traditto la loro vincualzione amatoria da me.

Donne schifosse comme Watts, Laura Elena, Feliu, hanno cadutto sotta gli effetti tentaculare dei boardiani.

Sono molto abandonata da tutto il popolo bogardiano.

Sono legitimamente zelosa et staffata per tutti l'uomini boagardistichi.

Io ho sognato molte notte da te: Oscar. Da te: Messagiero. Tutta la gente bogardina mi ha decceccionata
profondamente.

Forse tutto, magari tutto, cioe che sono dama angolosa et ritornero ai vostro cuore.

Forza la tiffa, fai fina et me ne vado a colazione per dimenticare il dramma della mia solitudine.

penyabogarde ha dit...

Monica,
no ens deixis, hem estat infidels però segur que ho pots comprendre i segur que tú mateixa has estat fent de les teves per Australia.


tema Clot:
fa molta patxoca la colla bogardera dalt del balcó... quina fila de lluitadors i lluitadores més ferma!

David Lara ha dit...

¿Qué mosca os ha picado ahora?
El Audi, el fantasmón de quita y pon qiue aparece y desaparece, la faja de la mejicana apretada, el lagrimitas Diango, vuestra revolucioncita de juguete, la rubia tutti frutti dándole al besuqueo con la morena, el pesado de Jordi L.P. que aburre sopas de pan.

Y nadie, ni nadie, ni nadie, se pregunta con que plantilla os vais a presentar a la supercopa de España.

Sinceramente sois la muestra más clara de ver el mundo por un tubo de bronce gastado.

¿Alguien puede decir que ha ganado con estas bromas?

Me suena todo a la pantalla para esconder problemas personales pues hay que eser obtuso como para dedicar horas y horas a semejante web de poco dividendo y alegría.

Lo que es triste, es muy pero que muy triste.

¿alguien puede explicar que se siente viendo esta tontería de web?

¿alguien?

Joan Estruch ha dit...

Amics Bogardes,

amb tant foc creuat i declaracions i contradeclaracions em trobo en una situació complicada ja que vosaltres disposeu de la identitat dels socis amb els que suposadament disputo amors. Semblava suficient posar el nom i així no ser un anònim però jo no tinc les tècnologies dels altres i a vegades pot semblar que no participo de la vida de la penya i de les seves visicituts.

Per això us passo la meva imatge i la meva cara per si penseu que us pot servir per quan em volgueu localitzar a les manifestacions o a altres moments de la vida esportiva o sentimental.

ara ja podeu fer que la meva imatge surti al blog, no em tallaré gens ni mica de ser part de la festa:

http://en.wikipedia.org/wiki/Boris_Karloff

El missatger ha dit...

Bé, solament puc dir que necessitàvem d’un sessió hipnòtico-suggestiva per intentar convèncer el subjecte F. de que és quedés a Anglaterra. El problema és que Wenger i el cap Sandrinista ja han arribat a un acord. Ara F. no vol venir però els seus amos ja l’han venut: típic del sandrinisme neolliberal.
La imatge del Clot amb la vella guàrdia bogardiste defensant els drets dels ciutadans demostra la grandesa del bogardisme i perquè el poble està amb ell. Volem un síndic bogardiste a totes les assemblees sandrinistes!

penyabogarde ha dit...

El sindic bogardista podria ser el company Estruch, Joan "Boris" Estruch. Ho parlarem a la junta...

David ha dit...

Molt astut l'Estruch amb el seu aspecte terrorífic.

Marta Ribera ha dit...

ostres Estruch, et cases i ens ensenyes la cara, coi si ets dels que fan por! felicitats per partida doble, casament i un bon càrrec.

SECRETARI DE LA PENYA ha dit...

!!! moltes felicitats Sr. Estruch!!! pel seu casament llampeg amb la Srta. Laura Elena (a partir d'ara Sra. d'Estruch) i pel seu nomenament com a nou Síndic de la Penya Bogarde.
De totes maneres,i no voldria enfosquir la seva felicitat, crec que la nostra Pubilla la Signorina Monica Bellucci mereix un aclariment públic per part de vostè sobre les causes del seu divorci (la integritat moral del seu nou càrrec l'obliga ) ja que ha estat una sorpresa majúscula després de les mostres d'amor que vostè mateix confesava en els seus comentaris anteriors ...

Ens veiem al Clot ...

Joan Estruch ha dit...

gràcies senyor retratista, la foto del casament ha quedat pistonuda

Joan Estruch ha dit...

sobre la Monica he de dir que la separació és amistosa i que la Laura Elena i un servidor ja li hem trobat una feineta: servei de neteja de la comunitat col·lectivitzada on anem a viure, tindrà un bon sou i tots els drets bàsics.

Òscar Roig i Carrera ha dit...

Sempre he estat un fan d'en Thiago, des de l'any 1999 com a mínim. És més, si jo fos en Pep Guardiola, jugarien en Thiago, en Messi i 8 més, que amb 10 es juga millor que amb 11, com va dir HH, i més si pots deixar el Villa a la banqueta. Em sap greu no entendré l'italià per poder contestar a la signorina, tot i que també sóc un gran fan del Franco. Del Franco Battiatto, no us espanteu! Trobo que tothom que combina la i i la a plegades al seu cognom mereix credibilitat i admiració.

LA JUNTA DIRECTIVA ha dit...

ummmmm....franco battiatto, podria ser l'embaixador de la pemya a Itàlia....franco battiatto il bogardino della Prospettiva Nevski.

en parlem a la junta.

Carles ha dit...

Amable Estruch:

La seva esposa a la foto fa cara de no trencar plats i sembla no donar massa importància a les seves atribucions físiques per la qual cosa cal dir que la seva esposa és dona de cervell ferm i de gran seguretat mental i en el benentès que tot això sigui així he de reconeixer que vostè és un privilegiat en aquest món de poca txitxa i massa imatge.

La meva enhorabona.

Carles

MADRIDISTA LITERARIO ha dit...

HOLA TONTOS, HOY SOY UN GRAN ESCRITOR QUE ESCRIBE UN CUENTO PARA TODA LA GENTE DE LA PEÑA BOGARDE O SEA QUE VAMOS AL GRANO.


LA DECADENCIA DEL CEREBRO PENSANTE
(AUTOR, EL MADRIDISTA QUE ESCRIBE BIEN)

MAÑANEABA OCIOSAMENTE HASTA QUE PEQUÉ DE CURIOSIDAD Y ME ACERQUÉ AL ORDENADOR SITO EN EL ESPACIO WIFI DE LA CASA DE VERANEO. ¡ PÚCHICA DIEGOS ! ME DIGO. Y ES QUE CUANDO LEÍA EL SERMÓN GRÁFICO Y LITERARIO DE LA PEÑA BARCELONISTA (NI-TA) DE BOGARDE ME TROPECÉ CON UN CEREBRO PENSANTE VENIDO A MENOS.

LA MASA CEREBRAL SE DESPARRAMABA POR EL SUELO Y ME SUGERÍA UNA AMALGAMA DE BERBERECHOS GRISES SUELTOS UNO A UNO. PERO NO ERAN DELICIOSOS BERBERECHOS. ERAN FRAGMENTOS EN DESCOMPOSIÓN DE LO QUE OTRORA SERÍA UN CEREBRO. CURIOSAMENTE PODÍAS CAPTAR GRACIAS A UNA VISCOSIDAD TRANSPARENTE LO QUE ERAN RESTOS DE PENSAMIENTO EN FORMA DE IMÀGENES CAMPANIFORMES DE PARTIDOS DE FUTBOL, ACTRICES DESNUDAS, INCENDIOS, COCHES DE LUJO, BANDERAS, CINE Y MEDICINA.

RECONSTRUYENDO FRAGMENTOS DE LOS BERBERECHEANTES RESTOS CEREBRALES PUDE CAPTAR LO QUE HABÍA SIDO UN EXPERIMENTO INTERNAUTICO INTERESANTE DENOMINADO PEÑA BOGARDE. UNA CIERTA GRACIA E INGENIO, UN SACAR PUNTA AL DETALLE, AUTOIRONÍA, LÓGICO ANTIMADRIDISMO, PERO TAMPOCO BADA DEL OTRO MUNDO.

LAS FASES DEL BOGARDERISMI-TO DIGITAL SE COMPLICARON CON DEMASIADAS ALUSIONES A LA VIRGEN DE MONTSERRAT, A LA COMIDA SUPER CALÓRICA, LUEGO EL TABACO Y SU FUMADOR CALIMOCHO, LUEGO Y POR PURA OBSESIÓN LA BURLA SUPINA HACIA EL REAL MADRID Y EN PARTICULAR HACIA MI PERSONA ATRIBUYENDOLE TODO TIPO DE BARBARIDADES FÍSICAS Y CONVIRTIENDO FALSAMENTE MI ASPECTO EN EL DE UN GORDO GLOTÓN.
ME VI OBLIGADO A COMPLEMENTAR MI VIDA CON ALGUNA MEDIDA DE SEGURIDAD Y ASÍ ENTRÓ EN ESCENA MI FIEL PERRO TOBÍAS.

ALGO QUE ME DA ASCO FINO ES EL LLAMADO MENSAJERO QUE SE LAS DA DE EXPERTO EN LINDECES, O JUAN ESTRUCH O ESTRUCHÓN DEL CABO DE GATA QUE VA DE LIGA LIGONERA PIM PAM PUM FUERA PERO DE BOQUILLA LARGA, OSCAR ESE QUE SE CREE CANTANTE, EL MALDITO JACKES TATI Y SU RIDICULO PARAGUAS, EL BALCELLS QUE SE TRAE A COLACIÓN DE CORRECTITO, LA MARTA QUE CAE DE VEZ EN CUANDO PARA PELOTEAR. EL SECRETARIO NO-SE-QUE-NO-SE-CUANTOS QUE FELICITA A CUALQUIER SUJETO QUE SE TERCIE.

NAFATALINA PURA. Y VUEVO A LO DE ANTES, CEREBRO ESPARCIDO Y DECAÍDO.

PUCHERO. MALO, MALO Y MUY MALO.


---- ¿ OS HA GUSTADO EL CUENTO ? ---

EL PERRO TOBÍAS ha dit...

Mi amo, a mi el cuento me ha gustao un porrón.

¿tengo derecho a morder barceloni-tas?

guau guau

MADRIDISTA ACEPTA ha dit...

POR SUPUESTO MI FIEL TOBÍAS, ERES EL REY DE LOS CANES Y MERECES MORDER.


PUEDES COMENZAR EL FESTÍN ARREANDOLE UN HACHAZO DE TUS COLMILLOS EN TODA LA PANTORRILLA DE DON JUANITO ESTRUCO A VER SI LES AMARGAMOS LA BODA.

¡¡¡ ADELANTE MI VALIENTE TOBÍAS !!!

EL PERRO TOBÍAS ha dit...

ggggggguauuuuu
gggggggguuuuuuauuuuuu
gorggggguuuuuu

makex mikox kpox xuks arggggg

pero que deliciosa es la pantorrilla de Estrucio


argkkkk kooooks graghhhhh
gagggggg

guauuuuuuuuu!!!!!!!!!!!

Robert ha dit...

som i estem de revolució
som i estem de pretemporada
som i estem de casament
som i estem lluitadors
som i estem de companyonia
som i estem d'estiu
som i estem bona gent

i hen de suportar un madridista amargat acompanyat d'un gos rabiós.

quina vida més mediocre la d'alguns!

El missatger ha dit...

Les forces vives del Sandrinisme, amb Flo Pérez, Julito Iglesias, Cuní-Basté, Pilar Rahola i la nena de l’Exorcista (la necessària quota femenina) es reuneixen sota el pompós nom de Gabinet de crisi a Cerdanyola per planificar les ajudes a un dels seus, el petit Núñez, uns dels pares del Sandrinisme, assetjat pel bogardisme. El petit Núñez va nodrir la doctrina del grup, amb lemes com el seu famós “Al sosi no se’l pot enganyar, però al contribuent sí”.

El petit Núñez s’ha reclòs en un dels seus edificis, el supositori d'Agbar, amenaçant de fer-lo servir amb tots els contribuents, però el bogardisme, amb Oleguer presa de la Pastilla al capdavant, està segur d’entrar-hi per portar al petit Núñez al seu lloc: les masmorres. Canten de nou “Ça ira, ça ira, la presa de la Pastilla”.

Algú pensava que el bogardisme no aconseguiria res? Primera victòria.

Anònim ha dit...

excel·lent dama aquesta Laura Goliat ben osteotosa i de mirada innocent.